This project is focused on the biodeterioration of stone cultural heritage caused by microorganisms forming biofilms, sampled from different sites. For these analyses diverse primers have been used to identify the communities of bacteria and eukaryota (including fungi). Regarding this, the first PCR and purification steps were concluded.
For the sequencing were use 3 sets of primers with specific adapter of your platform.
– 16S RNA gene (bacteria including cyanobacteria): Région V4: 515F = GTGCCAGCMGCCGCGGTAA and 806R = GGACTACHVGGGTWTCTAAT
– 18S RNA gene (eucaryotes including microalgae): Région V9: 1391f = GTACACACCGCCCGTC and EukBr = TGATCCTTCTGCAGGTTCACCTAC
– ITS (fungi): ITS1-F-pSTC = CCTTCGCCGACTGACTTGGTCATTTAGAGGAAGTAA and ITS4 = TCCTCCGCTTATTGATATGC
The number of samples are 36 = 12x PCR region 16S v4, 12x PCR region 18S v9 and 12x PCR region ITS1 – ITS4.
For this project it is necessary to do these analysis:
– Library: Illumina® Nextera XT index kit
– Sequencing: MiSeq Micro 500c production (target between 50k and 100k PE250 reads/sample)
– Analysis: quality control (FastQC + taxonomy)
